Requirement
Your assigned reading over the past two weeks has introduced you to the structure and function of DNA.
- Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells
- Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.
- Finally - using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.
-
- aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
-
- aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
1. Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells.
Gene expression is the cellular process of transforming the information in a cell's DNA into a sequence of amino acids, and the cell uses information in the mRNA to link specific amino acids in the correct order, producing a protein (Clark, Choi & Douglas, 2020). When the ligand binds to the internal receptor, the ligand-receptor complex moves into the nucleus, then binds to specific regulatory regions of the chromosomal DNA and promotes copying the information in a cell's DNA into a particular form of RNA called mRNA (Clark, Choi & Douglas, 2020).
Ribosomes are cellular structures which large protein and RNA complexes, and it works a vital role in protein synthesis (Clark, Choi & Douglas, 2020). Ribosomes receive their orders for protein synthesis from the nucleus where the DNA transcribes into messenger RNA, and the mRNA travels to the ribosomes, mRNA brings the amino acids to the ribosome that will then create protein (Clark, Choi & Douglas, 2020). After the protein is made, the mRNA separates from the ribosome, and the synthesized protein is released.
In eukaryotes, protein synthesis occurs in the cytoplasm, but in prokaryotes, protein synthesis begins even before the transcription of mRNA (MajorDifferences, 2021). The primary mRNA transcript in eukaryotes undergoes processing and splicing to change into a functional mRNA, but those changes do not occur in prokaryotes (MajorDifferences, 2021).
2. Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.
Epigenetic changes are reversible and do not change your DNA sequence, but they can change how our bodies read a DNA sequence; therefore, epigenetics refers to the study of how our behaviors and environment can cause changes that affect the way our genes work (Centers for Disease Control and Prevention., 2020). Certain mutations make us more likely to develop cancer; some epigenetic changes such as lifestyle, stressors, smoking, and diet increase your cancer risk. "Epigenetics can be used to help determine which type of cancer a person has or can help to find hard to detect cancers earlier" (Centers for Disease Control and Prevention., 2020, para. 4).
CDC also warns that germs or viruses can change your epigenetics to weaken the human immune system (Centers for Disease Control and Prevention., 2020). Recent research has focused on how viruses utilize aspects of the epigenetic machinery to enable the infection establishment, spread, and persistence, and researchers found that coronaviruses mediate epigenetic alterations by antagonizing host antigen presentation or activating interferon-response genes (Atlante et al., 2020). The study of epigenetics is indispensable for the development of therapeutic drugs and vaccines for COVID-19.
3. using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.
aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
↓↓↓
Ser-Cys-Tyr-Arg-Lys-Leu-Arg-Val-Asn-lle-Leu-Arg-Ala-Arg-Ser-Asn
aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
↓↓↓
Ser-Cys-lle-Glu-Asn-Cys-Glu-Stop
The second strand has a point deletion with respect to the first strand, and it changed the reading frame and stopped the translation process.
References
Atlante, S., Mongelli, A., Barbi, V., Martelli, F., Farsetti, A., & Gaetano, C. (2020). The epigenetic implication in coronavirus infection and therapy. Clinical Epigenetics, 12(1), 1-12. Retrieved from https://link.springer.com/article/10.1186/s13148-020-00946-x
Centers for Disease Control and Prevention. (2020). What is Epigenetics? Retrieved from https://www.cdc.gov/genomics/disease/epigenetics.htm
Clark, M.A., Choi, J. & Douglas, M. (2020). Biology 2e. Open Stax. Retrieved from https://openstax.org/books/biology-2e/pages/preface
Major Differences. (2021). Difference Between Prokaryotic and Eukaryotic Protein Synthesis. Retrieved from https://www.majordifferences.com/2013/10/difference-prokaryotic-and-vs.html
댓글